Prev. |  KEGG KO K06823 > 

RIKEN DNA Bank Human Resource - COL18A1

Gene ID NCBI Gene 80781 |  KEGG hsa:80781
Gene Symbol COL18A1
Protein Name collagen type XVIII alpha 1 chain
Synonyms KNO|KNO1|KS
Ortholog resources KEGG ortholog (KEGG orthology K06823) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017018 IRAK042J02 pCMV-SPORT6 BC023005 NM_130445 Partial/var
HGX027312 IRAK068E16 pCMV-SPORT6 BC033715 NM_130445 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041680 ARe04D08 pKA1U5 NM_130445.2  
CCTCCCAGCGGCGGCGGCTGCAGCGCGGCGGATCCGAGCGGGTGCACCGCGGCGGAGGAG
HKR059612 ARe49A12 pKA1U5 NM_130445.2  
GGGTCCGAGCGGGTTGCACCGCGGCGGAGGAGGCAGCATCCCGCGGCGCTGACGGTCCTG
HKR234144 ARiS085F24 pGCAP10 NM_130445.2  
GGCCCCGCCCCCTGCCCGGCCTCCCAGCGGCGGCGGCTGCAGCGCGGCGGTCCGAGCGGG
HKR260097 ARiS150E01 pGCAP10 NM_130445.2  
GGANCNGGTGCACCGCGGCGGAGGAGGCAGCATCCCGCGGCGCTGACGGTCCTGGGGAGA
HKR369301 RBd23E05 pGCAP10 NM_130445.2  
GACACCCAGGGCGACCCCGGTGAAGACGGAAAGCCGGGCGACACCGGGCCACAAGGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl