Prev. |  KEGG KO K16745 > 

RIKEN DNA Bank Human Resource - B9D2

Gene ID NCBI Gene 80776 |  KEGG hsa:80776
Gene Symbol B9D2
Protein Name B9 domain containing 2
Synonyms ICIS-1|JBTS34|MKS10|MKSR-2|MKSR2
Ortholog resources KEGG ortholog (KEGG orthology K16745) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081041 IRAL002K01 pOTB7 BC004157 NM_030578
HGY083603 IRAL009A03 pOTB7 BC004444 NM_030578 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324130 RBb10F10 pKA1U5 NM_030578.2  
AGCAACAACCACGGAAACCAAGACGAGCGCGGCTCGCNGAAGTATCGCGGCTTACATATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl