Prev. | 

RIKEN DNA Bank Human Resource - LIMD2

Gene ID NCBI Gene 80774 |  KEGG hsa:80774
Gene Symbol LIMD2
Protein Name LIM domain containing 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044130 IRAK110F10 pCMV-SPORT6 BC051812 NM_030576 Full
HGY085230 IRAL013B06 pOTB7 BC004400 NM_030576 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388411 RBd71A11 pGCAP10 NM_030576.3  
GGGCGGGGGCGGTGCAGCGATAAGGCGGTGGCGGCGGCGGTGGCTCGGGGACCACTGGTA
HKR444082 RBdS110D10 pGCAP10 NM_030576.3  
GCTTCCCGCACAGTCCTTCAGCCTGCGGGCCCAGGTGAAGGAGACCTGCGCCGCCTGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl