Prev. | 

RIKEN DNA Bank Human Resource - CPTP

Gene ID NCBI Gene 80772 |  KEGG hsa:80772
Gene Symbol CPTP
Protein Name ceramide-1-phosphate transfer protein
Synonyms GLTPD1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069902 IRAK174M14 pCMV-SPORT6 BC072454 NM_001029885 Partial
HGY085342 IRAL013F22 pOTB7 BC004366 NM_001029885 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044105 ARe10E09 pKA1U5 NM_001029885.1  
GGCCCGCACGGCGGCTACGGCCTANGTGAGCGGCTCGGACTCGGCGGCCGCACCTGCCCA
HKR218295 ARiS045M07 pGCAP10 NM_001029885.1  
GGTCGTCCTAGAGGGCCGGAGCGGGCGGGCGGCCGAGGACCCGGCTCCCGCGCAGGACGG
HKR374812 RBd37A12 pGCAP10 NM_001029885.1  
GGCCCGCACGGCGGCTACGGCCTAGGTGAGCGGCTCGGACTCGGCGGCCGCACCTGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl