Prev. | 

RIKEN DNA Bank Human Resource - PRR7

Gene ID NCBI Gene 80758 |  KEGG hsa:80758
Gene Symbol PRR7
Protein Name proline rich 7, synaptic
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027887 IRAK069L23 pCMV-SPORT6 BC033649 NM_030567 Full
HGY085545 IRAL013O09 pOTB7 BC004261 NM_030567 Full/var
HGY091260 IRAL028C12 pOTB7 BC021240 NM_030567 Full/var
HGY095472 IRAL038L08 pDNR-LIB BC024233 NM_030567 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096841 M01C042B17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE096889 M01C042D17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE096937 M01C042F17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE096985 M01C042H17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE097033 M01C042J17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE097081 M01C042L17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE097129 M01C042N17 pDONR221 MGC10-G09 BC024233 ENST00000323249  
HGE097177 M01C042P17 pDONR221 MGC10-G09 BC024233 ENST00000323249  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR416311 RBdS040M23 pGCAP10 NM_030567.3  
GGCTGCTCGCCCCGAGCCAGGAGAACGAGCTCGAGGAGGATGCCTGGGCCCGTCCCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl