Prev. | 

RIKEN DNA Bank Human Resource - SLC35G2

Gene ID NCBI Gene 80723 |  KEGG hsa:80723
Gene Symbol SLC35G2
Protein Name solute carrier family 35 member G2
Synonyms TMEM22
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012866 IRAK032C18 pBluescriptR BC022557 NM_025246 Full/var
HGX039308 IRAK098E12 pCMV-SPORT6 BC050423 NM_025246 Full/var
HGY082922 IRAL007F02 pOTB7 BC000111 NM_025246 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405957 RBdS014O21 pGCAP10 NM_001097599.1  
GGCCCGCCTCGATTTTCCCAGGCGAGGGCACGCCCGCGTCAGTCGCCTCCGGGGCACCTT
HKR453120 RBdS132N08 pGCAP10 NM_001097599.1  
TTGTGACGGCGCCCGCCTCGATTTTCCCAGGCGAGGGCACGCCCGCGTCAGTCGCCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl