Prev. |  KEGG KO K09230 > 

RIKEN DNA Bank Human Resource - ZSCAN16

Gene ID NCBI Gene 80345 |  KEGG hsa:80345
Gene Symbol ZSCAN16
Protein Name zinc finger and SCAN domain containing 16
Synonyms ZNF392|ZNF435|dJ265C24.3
Ortholog resource in our bank

  ZSCAN16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085217 IRAL013A17 pOTB7 BC004255 NM_025231 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038801 W01A097A01 pENTR-TOPO IRAL013A17 BC004255 NM_025231  
HGE038809 W01A097A09 pENTR-TOPO IRAL013A17 BC004255 NM_025231  
HGE038813 W01A097A13 pENTR-TOPO IRAL013A17 BC004255 NM_025231  
HGE048353 W01A120O17 pENTR-TOPO IRAL013A17 BC004255 NM_025231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR416130 RBdS040F10 pGCAP10 NM_025231.1  
GGTCTTTGAGTCTAGTCTTTGTTCGGGGCTGTCCAAAGGACGCTAGCTGTTGCACCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl