Prev. |  KEGG KO K11801 > 

RIKEN DNA Bank Human Resource - DCAF11

Gene ID NCBI Gene 80344 |  KEGG hsa:80344
Gene Symbol DCAF11
Protein Name DDB1 and CUL4 associated factor 11
Synonyms GL014|PRO2389|WDR23
Ortholog resource in our bank

  DCAF11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056383 IRAK140P23 pCMV-SPORT6 BC067132 NM_025230 Full/var
HGY090515 IRAL026E19 pOTB7 BC008858 NM_181357 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219701 ARiS049E05 pGCAP10 NM_025230.4  
GGAGATGCGTGACGAGCGAAGCGCGTGACGGAGGAGCGGTTGGCCAACGCAGTGGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl