Prev. |  KEGG KO K13534 > 

RIKEN DNA Bank Human Resource - PNPLA3

Gene ID NCBI Gene 80339 |  KEGG hsa:80339
Gene Symbol PNPLA3
Protein Name patatin like phospholipase domain containing 3
Synonyms ADPN|C22orf20|iPLA(2)epsilon
Ortholog resource in our bank

  PNPLA3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025396 W01A063I04 pENTR-TOPO flj0066a18 AK025665 NM_025225  
HGE025400 W01A063I08 pENTR-TOPO flj0066a18 AK025665 NM_025225  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR388052 RBd70C04 pGCAP10 NM_025225.2  
GAGAGAGCGCTTGCGGGCGCCGGGCGGAGCTGCTGCGGATCAGGACCCGAGCCGATTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl