Prev. |  KEGG KO K00953 > 

RIKEN DNA Bank Human Resource - FLAD1

Gene ID NCBI Gene 80308 |  KEGG hsa:80308
Gene Symbol FLAD1
Protein Name flavin adenine dinucleotide synthetase 1
Synonyms FAD1|FADS|LSMFLAD|PP591
Ortholog resources KEGG ortholog (KEGG orthology K00953) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025959 IRAK064O23 pCMV-SPORT6 BC032323 NM_201398 Full
HGY091383 IRAL028H15 pOTB7 BC014012 NM_201398 Partial/var
HGY096233 IRAL040J17 pOTB7 BC020253 NM_201398 Partial
HGY096316 IRAL040N04 pOTB7 BC021096 NM_201398 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078901 ARe97E05 pKA1U5 NM_025207.3  
GAACAAGGGAAAGAGCCGGTGAAGGGGCAGAACAGGCAGGTGAGAGTCTAAGAGGGCTCA
HKR388907 RBd72E11 pGCAP10 NM_025207.3  
GGGGAAAGAGCCGGTGAAGGGGCAGAACAGGCAGGTTCCCTCGACCCAGGACCCCCTGTT
HKR398529 RBd96F09 pGCAP10 NM_025207.3  
GATATAACAATCCGGCCCTGCTCCCATCCACTGGCTAAAGCCTGAGAGCGACAGTTGAAT
HKR416183 RBdS040H15 pGCAP10 NM_025207.3  
TTGAGGAAAGGAACAAGGGAAAGAGCCGGTGAAGGGGCAGAACAGGCAGGTGAGAGTCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl