Prev. |  KEGG KO K03687 > 

RIKEN DNA Bank Human Resource - GRPEL1

Gene ID NCBI Gene 80273 |  KEGG hsa:80273
Gene Symbol GRPEL1
Protein Name GrpE like 1, mitochondrial
Synonyms GrpE|HMGE|mt-GrpE#1
Ortholog resource in our bank

  GRPEL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018663 IRAK046K23 pBluescriptR BC024242 NM_025196

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042009 ARe05A09 pKA1U5 NM_025196.2  
GGCACTCACGCTTGGTGCGTGCGCGGCGACTGCGACGGGCAGTGGCAGTCATGGCGGCTC
HKR366152 RBd15G08 pGCAP10 NM_025196.2  
GGCACTCACGCTTGGTGCGTGCGCGGCGACTGCGACGGGCAGTGGCAGTCATGGCGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl