Prev. |  KEGG KO K16057 > 

RIKEN DNA Bank Human Resource - ORAI2

Gene ID NCBI Gene 80228 |  KEGG hsa:80228
Gene Symbol ORAI2
Protein Name ORAI calcium release-activated calcium modulator 2
Synonyms C7orf19|CBCIP2|MEM142B|TMEM142B
Ortholog resources KEGG ortholog (KEGG orthology K16057) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089662 IRAL024C14 pOTB7 BC009183 NM_032831 Partial
HGY093135 IRAL032N23 pDNR-LIB BC016797 NM_032831 Partial/var
HGY101756 IRAL054G12 pOTB7 BC069270 NM_032831 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279467 ARiS198L03 pGCAP10 NM_032831.1  
CGGCCGGCCGATGCCCGCGCGACCAGCGGAAGGAGGGAGGGGGCCGCGCTCGGCGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl