Prev. | 

RIKEN DNA Bank Human Resource - FUZ

Gene ID NCBI Gene 80199 |  KEGG hsa:80199
Gene Symbol FUZ
Protein Name fuzzy planar cell polarity protein
Synonyms CPLANE3|FY|NTD
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081141 IRAL002O05 pOTB7 BC016793 NM_025129
HGY083659 IRAL009C11 pOTB7 BC004445 NM_025129 Full
HGY090852 IRAL027C04 pOTB7 BC010092 NM_025129 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330948 RBb27G04 pGCAP1 NM_025129.3  
TGCTCTTCCATCAGCTCCCCATCTCGCCCTCTGGCGGCTCCGGACCACAGGCCGAGTTAC
HKR374076 RBd35D04 pGCAP10 NM_025129.3  
GGATTACCGCCATGCTCCAAGACCCGCACTGACAGTCCCCACGTGAGGGACCGCGGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl