Prev. |  KEGG KO K10343 > 

RIKEN DNA Bank Human Resource - SPSB1

Gene ID NCBI Gene 80176 |  KEGG hsa:80176
Gene Symbol SPSB1
Protein Name splA/ryanodine receptor domain and SOCS box containing 1
Synonyms SSB-1|SSB1
Ortholog resource in our bank

  SPSB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006257 IRAK015K17 pCMV-SPORT6 BC015711 NM_025106
HGY081263 IRAL003C15 pOTB7 BC005852 NM_025106 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR121772 ARh04H04 pGCAP1 NM_025106.3  
TGGGCACAGAAGTCGCGCTCGGGCAGCCTGCGCGCTCCCATTAGGAACCAGGCTCCAGGC
HKR474907 RBdS187E11 pGCAP10 NM_025106.3  
GNNNTNAAAGCCGTCGGTTGCTTTTTCTCCTCCGCACAGAAGTCGCGCTCGGGCAGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl