Prev. |  KEGG KO K12615 > 

RIKEN DNA Bank Human Resource - EDC3

Gene ID NCBI Gene 80153 |  KEGG hsa:80153
Gene Symbol EDC3
Protein Name enhancer of mRNA decapping 3
Synonyms LSM16|MRT50|YJDC|YJEFN2|hYjeF_N2-15q23
Ortholog resource in our bank

  EDC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005571 IRAK013P11 pCMV-SPORT6 BC011534 NM_025083
HGY095745 IRAL039G01 pOTB7 BC021271 NM_025083 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR470851 RBdS177C03 pGCAP10 NM_025083.3  
GGCGCTTCCGGCAGCGGCGGCGGTGGTGAAGGCCGATGCTGTGGGGGTGGGCGTGGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl