Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASRGL1

Gene ID (NCBI) 80150
Gene Symbol ASRGL1
Protein Name asparaginase like 1
Synonyms ALP|ALP1|CRASH
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056200 IRAK140I08 pCMV-SPORT6 BC064963 NM_025080 Full/var
HGY095634 IRAL039B10 pOTB7 BC021295 NM_025080 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR049275 ARe23D03 pKA1U5 NM_025080.3
GGTTGTGACCAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGT
HKR373699 RBd34E03 pGCAP10 NM_025080.3
GGTTGTGACCAGAGCGGTTGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGT
HKR376457 RBd41C09 pGCAP10 NM_025080.3
GAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGG
HKR346953 RBb67G09 pGCAP1 NM_025080.3
TGGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGGCTGCGGGGCTGGCTCGACCCAGCTT
HKR393634 RBd84B10 pGCAP10 NM_025080.3
GAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGG
HKR396430 RBd91B06 pGCAP10 NM_025080.3
GGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGGCTGCGGGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl