Prev. |  KEGG KO K13051 > 

RIKEN DNA Bank Human Resource - ASRGL1

Gene ID NCBI Gene 80150 |  KEGG hsa:80150
Gene Symbol ASRGL1
Protein Name asparaginase and isoaspartyl peptidase 1
Synonyms ALP|ALP1|CRASH
Ortholog resources KEGG ortholog (KEGG orthology K13051) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056200 IRAK140I08 pCMV-SPORT6 BC064963 NM_025080 Full/var
HGY095634 IRAL039B10 pOTB7 BC021295 NM_025080 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049275 ARe23D03 pKA1U5 NM_025080.3  
GGTTGTGACCAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGT
HKR346953 RBb67G09 pGCAP1 NM_025080.3  
TGGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGGCTGCGGGGCTGGCTCGACCCAGCTT
HKR373699 RBd34E03 pGCAP10 NM_025080.3  
GGTTGTGACCAGAGCGGTTGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGT
HKR376457 RBd41C09 pGCAP10 NM_025080.3  
GAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGG
HKR393634 RBd84B10 pGCAP10 NM_025080.3  
GAGAGCGGTGGCGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGG
HKR396430 RBd91B06 pGCAP10 NM_025080.3  
GGGGCTGAGCGGTTTCGAGCCGGCGTCGGGGAGCGGCGGTACCGGGCGGCTGCGGGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl