Prev. |  KEGG KO K08678 > 

RIKEN DNA Bank Human Resource - UXS1

Gene ID NCBI Gene 80146 |  KEGG hsa:80146
Gene Symbol UXS1
Protein Name UDP-glucuronate decarboxylase 1
Synonyms SDR6E1|UGD
Ortholog resource in our bank

  UXS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090018 IRAL025A18 pOTB7 BC009819 NM_025076 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084848 M01C012B24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE084896 M01C012D24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE084944 M01C012F24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE084992 M01C012H24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE085040 M01C012J24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE085088 M01C012L24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE085136 M01C012N24 pDONR221 FLJ03-H12 AK075120 NM_025076  
HGE085184 M01C012P24 pDONR221 FLJ03-H12 AK075120 NM_025076  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182551 ARi56G07 pGCAP10 NM_025076.3  
GGGGGCCGCTGCCGCCGACGCCGCCGCGCATTGTGCAGCAGGCGGGCCCCCGCGCGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl