Prev. |  KEGG KO K12656 > 

RIKEN DNA Bank Human Resource - SIKE1

Gene ID NCBI Gene 80143 |  KEGG hsa:80143
Gene Symbol SIKE1
Protein Name suppressor of IKBKE 1
Synonyms SIKE
Ortholog resource in our bank

  SIKE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088504 IRAL021E08 pDNR-LIB BC005934 NM_025073 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189299 ARi73E03 pGCAP10 NM_025073.2  
GAATGCTGAGGCAAACTCCCCCAAGATCTGAACTAGTCGCGCACCTGACCCCAGCCCGGG
HKR373746 RBd34G02 pGCAP10 NM_025073.2  
GGGGGACAGCGCTTCCGGACCAGGTCAGGCAGAGGGTAGGAGTCCAGTGCTCTCGGATTC
HKR471052 RBdS177K12 pGCAP10 NM_025073.2  
GGAGCTGCACCATCGAGAAGATCCTGACAGACGCCAAGACGCTGCTGGAGAGGCTACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl