Prev. |  KEGG KO K05309 > 

RIKEN DNA Bank Human Resource - PTGES2

Gene ID NCBI Gene 80142 |  KEGG hsa:80142
Gene Symbol PTGES2
Protein Name prostaglandin E synthase 2
Synonyms C9orf15|GBF-1|GBF1|PGES2|mPGES-2
Ortholog resource in our bank

  PTGES2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07641 pcDNA3.1(+)cs-h Prostaglandin E synthase 2 (v1)

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086079 IRAL015D07 pOTB7 BC011613 NM_198940 Full
HGY089429 IRAL023J13 pOTB7 BC009456 NM_198940 Full
HGY090679 IRAL026L15 pOTB7 BC009397 NM_198940 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171655 ARi29C07 pGCAP10 NM_025072.5  
GGGAGCGAACATGGACCCGGCTGCGCGGGTGGTGCGGGCGCTGTGGCCTGGTGGGTGCGC
HKR235408 ARiS088I16 pGCAP10 NM_025072.5  
GATGGACCCGGCTGCGCGGGTGGTGCGGGCGCTGTGGCCTGGTGGGTGCGCCTTGGCCTG
HKR276437 ARiS191B13 pGCAP10 NM_025072.5  
GGGAGCGAACATGGACCCGGCTGCGCGGGTGGTGCGGGCGCTGTGGCCTGGTGGGTGCGC
HKR378873 RBd47D01 pGCAP10 NM_025072.5  
GGGAGCGAACATGGACCCGGCTGCGCGGGTGGTGCGGGCGCTGTGGCCTGGTGGGTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl