Prev. |  KEGG KO K17973 > 

RIKEN DNA Bank Human Resource - NAA25

Gene ID NCBI Gene 80018 |  KEGG hsa:80018
Gene Symbol NAA25
Protein Name N-alpha-acetyltransferase 25, NatB auxiliary subunit
Synonyms C12orf30|MDM20|NAP1
Ortholog resources KEGG ortholog (KEGG orthology K17973) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036158 IRAK090G14 pBluescript BC047640 NM_024953 Partial/var
HGY100248 IRAL050K08 pOTB7 BC065481 NM_024953 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180010 ARi50A10 pGCAP10 NM_024953.2  
GGCTTGTCATCATGGCGACGCGGGGCCATGTGCAGGACCCTAACGACAGGCGCCTCCGGC
HKR378932 RBd47F12 pGCAP10 NM_024953.2  
TGGCTTGTCNTCATGGCGACNCGGGGCCATGTGCAGGACCCTAACGACAGGCGCCTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl