Prev. | Human A to Z list > F > 

RIKEN DNA Bank Human Resource - FAM188A

Gene ID (NCBI) 80013
Gene Symbol FAM188A
Protein Name family with sequence similarity 188, member A
Synonyms C10orf97|CARP|DERP5|MST126|RP11-394I23.1|my042
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056682 IRAK141L18 pCMV-SPORT6 BC061585 NM_024948 Partial/var
HGY067217 IRAK168A17 pBluescriptR BC067799 NM_024948 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR361774 RBd04H06 pGCAP10 NM_024948.2
GGGCACCAGCACTTCCGGTACGGAAAACTCGCTGCTGCCCCAACCTGGCTTGACAGGCTT
HKR397748 RBd94G04 pGCAP10 NM_024948.2
GGGTACGGAAAACTCGCTGCTGCCCCAACCTGGCTTGACAGGCTTGGTCTCTGCAAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl