Prev. | 

RIKEN DNA Bank Human Resource - PSME3IP1

Gene ID NCBI Gene 80011 |  KEGG hsa:80011
Gene Symbol PSME3IP1
Protein Name proteasome activator subunit 3 interacting protein 1
Synonyms C16orf94|CDA018|CDA10|FAM192A|NIP30|PIP30
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008287 IRAK020L23 pCMV-SPORT6 BC020536 NM_024946 Full
HGY103467 IRAL058L03 pOTB7 BC071952 NM_024946 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175232 ARi38B08 pGCAP10 NM_024946.2  
GGGCCGGAAGTGGGGCGGGACTCTATTGTGGCGATTGGTTGTTTCATTATGGATGGAGGG
HKR260251 ARiS150K11 pGCAP10 NM_024946.2  
GCTATTGTGGCGGTGAGGANCAGGAAGCCCTGAAGGGTCAAAAGAAATACAAAAGCAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl