Prev. | 

RIKEN DNA Bank Human Resource - PLEKHH3

Gene ID NCBI Gene 79990 |  KEGG hsa:79990
Gene Symbol PLEKHH3
Protein Name pleckstrin homology, MyTH4 and FERM domain containing H3
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044343 IRAK110O07 pCMV-SPORT6 BC052978 NM_024927
HGY093961 IRAL034P01 pOTB7 BC016062 NM_024927 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363705 RBd09E09 pGCAP10 NM_024927.4  
GGGGGCTGCAGGGAGCGCAGCGCGCGCGGCCCGGGCCCCGGCCACCGGACGCCCTACCGG
HKR397259 RBd93C11 pGCAP10 NM_024927.4  
GTTCCCGGGGCTGCAGGGAGCGCGGCGCGCGCGGCCCGGGCCCCGGCCCCCGGACCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl