Prev. |  KEGG KO K09520 > 

RIKEN DNA Bank Human Resource - DNAJB14

Gene ID NCBI Gene 79982 |  KEGG hsa:79982
Gene Symbol DNAJB14
Protein Name DnaJ heat shock protein family (Hsp40) member B14
Synonyms EGNR9427|PRO34683
Ortholog resource in our bank

  DNAJB14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095108 IRAL037M20 pDNR-LIB BC022248 NM_024920

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096833 M01C042B09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE096881 M01C042D09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE096929 M01C042F09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE096977 M01C042H09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE097025 M01C042J09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE097073 M01C042L09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE097121 M01C042N09 pDONR221 MGC10-G05 BC022248 NM_001031723  
HGE097169 M01C042P09 pDONR221 MGC10-G05 BC022248 NM_001031723  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051202 ARe28A02 pKA1U5 NM_001031723.2  
AAGGAGCAAGCTATGGAGGGGAACAGGGNATGAGGCTGAGAAATGTGTCGAGATCGCCCG
HKR161276 ARi03D04 pGCAP10 NM_001031723.2  
GGGAGCAAGCTATGGAGGGGAACAGGGATGAGGCTGAGAAATGTGTCGAGATCGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl