Prev. |  KEGG KO K11778 > 

RIKEN DNA Bank Human Resource - DHDDS

Gene ID NCBI Gene 79947 |  KEGG hsa:79947
Gene Symbol DHDDS
Protein Name dehydrodolichyl diphosphate synthase subunit
Synonyms CIT|CPT|DEDSM|DS|HDS|RP59|hCIT
Ortholog resource in our bank

  DHDDS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084771 IRAL011P11 pOTB7 BC003643 NM_205861 Full/var
HGY085712 IRAL014E16 pOTB7 BC004117 NM_205861 Full/var
HGY096633 IRAL041J17 pDNR-LIB BC034152 NM_205861 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372106 RBd30E10 pGCAP10 NM_024887.2  
GGTGGGGACGCGCCCAGCGGAGCTAATCAGATTACCTGGCTGGTGTTTGCTTGTTCTGGA
HKR453014 RBdS132I22 pGCAP10 NM_024887.2  
GAGCCGTGGGGACGCGCCCAGCGGAGCTAATCAGATTACCTGGCTGGTGTTTGCTTGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl