Prev. |  KEGG KO K15283 > 

RIKEN DNA Bank Human Resource - SLC35E1

Gene ID NCBI Gene 79939 |  KEGG hsa:79939
Gene Symbol SLC35E1
Protein Name solute carrier family 35 member E1
Synonyms -
Ortholog resource in our bank

  SLC35E1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087156 IRAL017O20 pOTB7 BC007731 NM_024881 Partial/var
HGY100382 IRAL050P22 pOTB7 BC062562 NM_024881

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054107 ARe35E11 pKA1U5 NM_024881.4  
GCGCCCGGCGTCGGGCCGTCGGACGGGCTGGAANGNGCGGCCGCTCGGGCAGGATGGCGG
HKR065347 ARe63G03 pKA1U5 NM_024881.4  
GGCCCGGCGCTCGGGCCGTCNGACGGNTCTGGAACGNGCGGCCGCTCGGGCAGGATGGCG
HKR176146 ARi40G02 pGCAP10 NM_024881.4  
GGCGGCCGCTCGGGCAGGATGGCGGCGGCCGCGGTGGGCGCGGGCCACGGCGCGGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl