Prev. | 

RIKEN DNA Bank Human Resource - KIAA0319L

Gene ID NCBI Gene 79932 |  KEGG hsa:79932
Gene Symbol KIAA0319L
Protein Name KIAA0319 like
Synonyms AAVR|AAVRL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020852 IRAK052C04 pCMV-SPORT6 BC031672 NM_182686 Partial
HGY084759 IRAL011O23 pOTB7 BC001858 NM_182686 Partial
HGY085904 IRAL014M16 pOTB7 BC014530 NM_024874 Full/var
HGY089441 IRAL023K01 pOTB7 BC007645 NM_182686 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR160499 ARi01E03 pGCAP10 NM_024874.3  
GGTTTCCGGCCGCCGTCGCTGTCCAGGGAGGCTGAGGCGAGAGGTAGCTGTCCGGGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl