Prev. | 

RIKEN DNA Bank Human Resource - TCEAL4

Gene ID NCBI Gene 79921 |  KEGG hsa:79921
Gene Symbol TCEAL4
Protein Name transcription elongation factor A like 4
Synonyms NPD017|WEX7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001298 IRAK003E02 pCMV-SPORT6 BC012296 NM_024863 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162482 ARi06D10 pGCAP10 NM_024863.4  
TCAGCAATGAGGACATGATAAGAGAATTTGACAATATGGCTAAGGTGCANGATGANAANA
HKR170803 ARi27A03 pGCAP10 NM_024863.4  
GGCGCAGATGTAGGCACCGGTCCGAGTGCCTGCCCTCTGTCCCCGCGGCTGGGTCTCGTC
HKR182973 ARi57H05 pGCAP10 NM_024863.4  
GCCCGCCCGCCCTGCGGTCCGGTCCTGGCGCCCGCGCAGAACCAGCTGTCTGAGCTGCCC
HKR348453 RBb71C05 pGCAP1 NM_024863.4  
GGCACGGGCGCAGATGTAGGCACCGGTCCGAGTGCCTGCCCTCTGTCCCCGCGGCTGGGT
HKR432784 RBdS081P24 pGCAP10 NM_024863.4  
GCAGATGTNNGCACCNGTCCNAGTGCCTGCCCTCTGTCCCCGCGGCTGGGTCTCGTCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl