Prev. |  KEGG KO K11672 > 

RIKEN DNA Bank Human Resource - ACTR5

Gene ID NCBI Gene 79913 |  KEGG hsa:79913
Gene Symbol ACTR5
Protein Name actin related protein 5
Synonyms Arp5|INO80M
Ortholog resources KEGG ortholog (KEGG orthology K11672) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001881 IRAK004L17 pCMV-SPORT6 BC001324 NM_024855 Partial/var
HGX020379 IRAK050P19 pCMV-SPORT6 BC038402 NM_024855
HGY087452 IRAL018K12 pOTB7 BC006162 NM_024855 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444218 RBdS110J02 pGCAP10 NM_024855.3  
GGGACGCGCGCTCCAAGATGGCGGCGAACGTGTTCCCGTTCCGCGACGCCCGTGCCGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl