Prev. |  KEGG KO K21121 > 

RIKEN DNA Bank Human Resource - NAA60

Gene ID NCBI Gene 79903 |  KEGG hsa:79903
Gene Symbol NAA60
Protein Name N-alpha-acetyltransferase 60, NatF catalytic subunit
Synonyms HAT4|NAT15|NatF|hNaa60
Ortholog resource in our bank

  NAA60

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005053 IRAK012K13 pCMV-SPORT6 BC011267 NM_024845 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053680 ARe34D08 pKA1U5 NM_024845.2  
GCCCGGCTGCGGCCCCTGCCGGTTACATAACTCGTTGCGGGCTCCGCGCGGTCCCACATT
HKR247436 ARiS118J20 pGCAP10 NM_024845.2  
GGCCTCCGTCCCGGCTGCGGCCCCTGCCGGTTACATAACTCGTTGCGGGCTCCGCGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl