Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUP85

Gene ID (NCBI) 79902
Gene Symbol NUP85
Protein Name nucleoporin 85kDa
Synonyms Nup75
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082328 IRAL005N16 pOTB7 BC000697 NM_024844 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR370427 RBd26B03 pGCAP10 NM_024844.3
GAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGGAGCTCGA
HKR398927 RBd97F07 pGCAP10 NM_024844.3
GAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGG
HKR399233 RBd98B09 pGCAP10 NM_024844.3
GAGAGGGTGNCGTGNTGAGANAGACAGCGCGCAGCACTGNGNTTGGCTGCAGGCGCTGCA
HKR420768 RBdS051P08 pGCAP10 NM_024844.3
GCTGAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl