Prev. |  KEGG KO K14304 > 

RIKEN DNA Bank Human Resource - NUP85

Gene ID NCBI Gene 79902 |  KEGG hsa:79902
Gene Symbol NUP85
Protein Name nucleoporin 85
Synonyms FROUNT|NPHS17|Nup75
Ortholog resource in our bank

  NUP85

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082328 IRAL005N16 pOTB7 BC000697 NM_024844 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370427 RBd26B03 pGCAP10 NM_024844.3  
GAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGGAGCTCGA
HKR398927 RBd97F07 pGCAP10 NM_024844.3  
GAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGGAGG
HKR399233 RBd98B09 pGCAP10 NM_024844.3  
GAGAGGGTGNCGTGNTGAGANAGACAGCGCGCAGCACTGNGNTTGGCTGCAGGCGCTGCA
HKR420768 RBdS051P08 pGCAP10 NM_024844.3  
GCTGAGCGGGAAGCATTGGCGTCCGAGCGACTTCTAGGAGCCTGGGGTTCGGCGCTATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl