Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GGNBP2

Gene ID (NCBI) 79893
Gene Symbol GGNBP2
Protein Name gametogenetin binding protein 2
Synonyms DIF-3|DIF3|LCRG1|LZK1|ZFP403|ZNF403
Databases KEGG hsa:79893 |  NCBI Gene 79893


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015007 W01A037I15 pENTR-TOPO flj0065m02 AK024883 NM_024835  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060498 ARe51E02 pKA1U5 NM_024835.2  
TGGGCAGAAACAGCAGCGGCGGCGGCGGCGGCAGCTGGGAGGAGGTGGTGACGGTGGCAA
HKR325211 RBb13A11 pKA1U5 NM_024835.2  
GACTCCCCGCGGCGCGAGCGGCTGACTGCCCGTAGAGGAAACGACATTCGGAGCTGCGCT
HKR380076 RBd50D04 pGCAP10 NM_024835.2  
GGTAGAGGAACGACATTCGGAGCTGCGCTCCCGCCCAGGCCGGCCCTGCCGCGNNCTCGT
HKR393323 RBd83F03 pGCAP10 NM_024835.2  
GGTAGAGGAAACGACATTCGGAGCTGCGCTCCCGCCCAGGCCGGCCCTGCCGCGGGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl