Prev. | 

RIKEN DNA Bank Human Resource - DCAKD

Gene ID NCBI Gene 79877 |  KEGG hsa:79877
Gene Symbol DCAKD
Protein Name dephospho-CoA kinase domain containing
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007728 IRAK019F08 pCMV-SPORT6 BC033299 NM_024819 Full/var
HGX008982 IRAK022H14 pCMV-SPORT6 BC018132 NM_024819 Full/var
HGY081163 IRAL002P03 pOTB7 BC006546 NM_024819
HGY083735 IRAL009F15 pOTB7 BC006472 NM_024819 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR416206 RBdS040I14 pGCAP10 NM_024819.4  
GATTCGGCCACGCTTTGAGGAAAGAAGGGGCGCAAGGTTGGTGGGACCGACCCTTGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl