Prev. |  KEGG KO K07432 > 

RIKEN DNA Bank Human Resource - ALG13

Gene ID NCBI Gene 79868 |  KEGG hsa:79868
Gene Symbol ALG13
Protein Name ALG13 UDP-N-acetylglucosaminyltransferase subunit
Synonyms CDG1S|CXorf45|EIEE36|GLT28D1|MDS031|TDRD13|YGL047W
Ortholog resource in our bank

  ALG13

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086428 IRAL016B04 pDNR-LIB BC005336 NM_018466 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078921 ARe97F01 pKA1U5 NM_018466.3  
ATCCTGATATCCGGCCCTTGCGATCAGGGCTTGAGGAACCCGCGCCATGAAGTGCGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl