Prev. | 

RIKEN DNA Bank Human Resource - CCDC102B

Gene ID NCBI Gene 79839 |  KEGG hsa:79839
Gene Symbol CCDC102B
Protein Name coiled-coil domain containing 102B
Synonyms ACY1L|AN|C18orf14|HsT1731
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366177 RBd15H09 pGCAP10 NM_001093729.1  
GACTAGGGAAAACGGTGCTGGTTCACTGGGGCGCGTTTCCGGGAAGGTGAATACCGGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl