Prev. | 

RIKEN DNA Bank Human Resource - LONRF3

Gene ID NCBI Gene 79836 |  KEGG hsa:79836
Gene Symbol LONRF3
Protein Name LON peptidase N-terminal domain and ring finger 3
Synonyms RNF127
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175279 ARi38D07 pGCAP10 NM_024778.5 Parcial done
GGCCGACCGGCGCTGTGCGCTGTGCGGGGTCAAGCTCTCCGCCTTGATGGTGGCCACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl