Prev. | 

RIKEN DNA Bank Human Resource - SLTM

Gene ID NCBI Gene 79811 |  KEGG hsa:79811
Gene Symbol SLTM
Protein Name SAFB like transcription modulator
Synonyms Met
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX043150 IRAK107O14 pCMV-SPORT6 BC046119 NM_024755 Partial
HGY093803 IRAL034I11 pOTB7 BC014944 NM_017968 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE026880 W01A067D08 pENTR-TOPO flj0014p16 AK055195 NM_017968  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370527 RBd26F07 pGCAP10 NM_024755_4 done
GGCTGCTCTTCTAAGATGGCTGCCGCTACCGGTGCGGTGGCAGCCTCGGCCGCCTCGGGT
HKR370856 RBd27C08 pGCAP10 NM_024755.2  
GGCTCTTCTAAGATGGCTGCCGCTACCGGTGCGGTGGCAGCCTCGGCCGCCTCGGGTCAG
HKR416077 RBdS040D05 pGCAP10 NM_024755.2  
GCACTCGCTGCCTCGGCAGCGCGCTGCTCTTCTAAGATGGCTGCCGCTACCGGTGCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl