Prev. |  KEGG KO K20192 > 

RIKEN DNA Bank Human Resource - HPS6

Gene ID NCBI Gene 79803 |  KEGG hsa:79803
Gene Symbol HPS6
Protein Name HPS6 biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms BLOC2S3
Ortholog resource in our bank

  HPS6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093883 IRAL034L19 pOTB7 BC014993 NM_024747 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372908 RBd32E12 pGCAP10 NM_024747.4  
GGGAGTCGACGCTCGGCCCGGCCTCTGCTCACCTCATCCACGGGAGACGGAAGTCTTGGC
HKR442240 RBdS105J24 pGCAP10 NM_024747.4  
GGGAAGTCTTGGCCCTGCTCCGCTCCCCCGAGAATCGGGCCTCGCCCTGCTGGGCGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl