Prev. | 

RIKEN DNA Bank Human Resource - ECHDC3

Gene ID NCBI Gene 79746 |  KEGG hsa:79746
Gene Symbol ECHDC3
Protein Name enoyl-CoA hydratase domain containing 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005748 IRAK014G04 pCMV-SPORT6 BC009617 NM_024693 Full
HGY083063 IRAL007K23 pOTB7 BC001091 NM_024693 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072905 ARe82E09 pKA1U5 NM_024693.4  
GGGACTGGGCCTGGCCTGGGGCGTCCCCGCGAAGCCTGGGCCTGTCAGGCGGTTCCGTCC
HKR368032 RBd20B08 pGCAP10 NM_024693.4  
GGGGGCGTGCCGGGGCGGGGCGTAGTACGGACTGGGCCTGGCCTGGGGCGTCCCCGCGAA
HKR416247 RBdS040K07 pGCAP10 NM_024693.4  
GTGGGCCTGGCCTGGGGCGTCCCCGCGAAGCCTGGGCCTGTCAGGCGGTTCCGTCCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl