Prev. |  KEGG KO K16583 > 

RIKEN DNA Bank Human Resource - TTLL7

Gene ID NCBI Gene 79739 |  KEGG hsa:79739
Gene Symbol TTLL7
Protein Name tubulin tyrosine ligase like 7
Synonyms -
Ortholog resource in our bank

  TTLL7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053532 IRAK133N20 pBluescript BC060878 NM_024686 Full
HGY013707 IRAK034E11 pBluescriptR BC028350 NM_024686
HGY042747 IRAK106O11 pBluescript BC048970 NM_024686 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235314 ARiS088E18 pGCAP10 NM_024686.4  
GAGGCACTCCGCGTCGAGCACCGGAGTCCCGAGCCGTGGCTGCCACGGGCGGTGGGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl