Prev. |  KEGG KO K17658 > 

RIKEN DNA Bank Human Resource - TEFM

Gene ID NCBI Gene 79736 |  KEGG hsa:79736
Gene Symbol TEFM
Protein Name transcription elongation factor, mitochondrial
Synonyms C17orf42
Ortholog resources KEGG ortholog (KEGG orthology K17658) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005066 IRAK012L02 pCMV-SPORT6 BC009025 NM_024683
HGX069928 IRAK174N16 pCMV-SPORT6 BC073169 NM_024683 Partial/var
HGY094155 IRAL035G11 pDNR-LIB BC024328 NM_024683 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR121352 ARh03G08 pGCAP1 NM_024683.3  
GAATGGAGGAAGACTGGACCTACTGATTCAACTTGGAGCATGTTGCGGGTCTGTCCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl