Prev. |  KEGG KO K11419 > 

RIKEN DNA Bank Human Resource - SUV39H2

Gene ID NCBI Gene 79723 |  KEGG hsa:79723
Gene Symbol SUV39H2
Protein Name suppressor of variegation 3-9 homolog 2
Synonyms KMT1B
Ortholog resource in our bank

  SUV39H2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086890 IRAL017D18 pOTB7 BC007754 NM_024670
HGY096443 IRAL041B19 pDNR-LIB BC029360 NM_024670

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019108 W01A047M20 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019110 W01A047M22 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019138 W01A047O02 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019140 W01A047O04 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019144 W01A047O08 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019148 W01A047O12 pENTR-TOPO IRAL017D18 BC007754 NM_024670  
HGE019150 W01A047O14 pENTR-TOPO IRAL017D18 BC007754 NM_024670  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279213 ARiS198A13 pGCAP10 NM_024670.3  
TTTTAGTTTGAATGAAAGCTCTACAAGATGGCGGCGGTCGGGGCCGAGGCGCGAGGAGGA
HKR430151 RBdS075G07 pGCAP10 NM_024670.3  
GAGTTTGAATGAAAGCTCTACAAGATGGCGGCGGTCGGGGCCGAGGCGCGAGGAGGATAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl