Prev. | 

RIKEN DNA Bank Human Resource - CCDC51

Gene ID NCBI Gene 79714 |  KEGG hsa:79714
Gene Symbol CCDC51
Protein Name coiled-coil domain containing 51
Synonyms MITOK
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008438 IRAK021B14 pCMV-SPORT6 BC011993 NM_024661 Full
HGY085556 IRAL013O20 pOTB7 BC004341 NM_024661 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388978 RBd72H10 pGCAP10 NM_024661.3  
GAGACGATTGGTCGGGCCACGCCAGATCTCAGGATGATGGGGCGCAGCCCTGGGTTTGCC
HKR428129 RBdS070F09 pGCAP10 NM_024661.3  
GAGACGATTGGTCGGGCCACGCCAGCCCAGGCCCAAGCCAGCCCGGAGAGAAAAGACCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl