Prev. | 

RIKEN DNA Bank Human Resource - GTDC1

Gene ID NCBI Gene 79712 |  KEGG hsa:79712
Gene Symbol GTDC1
Protein Name glycosyltransferase like domain containing 1
Synonyms Hmat-Xa|mat-Xa
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010815 IRAK027A15 pCMV-SPORT6 BC017741 NM_024659
HGY099282 IRAL048D10 pDNR-LIB BC061699 NM_024659 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092440 M01C031B16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092488 M01C031D16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092536 M01C031F16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092584 M01C031H16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092632 M01C031J16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092680 M01C031L16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092728 M01C031N16 pDONR221 MGC05-D08 BC017741 NM_024659  
HGE092776 M01C031P16 pDONR221 MGC05-D08 BC017741 NM_024659  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380975 RBd52H07 pGCAP10 NM_024659.2  
GAGACAAGGAGGAGGAGGAGGAGGAGGTGACACTGATGATAAAAATCCATCCAAGAATTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl