Prev. |  KEGG KO K00710 > 

RIKEN DNA Bank Human Resource - GALNT12

Gene ID NCBI Gene 79695 |  KEGG hsa:79695
Gene Symbol GALNT12
Protein Name polypeptide N-acetylgalactosaminyltransferase 12
Synonyms CRCS1|GalNAc-T12
Ortholog resource in our bank

  GALNT12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054402 ARe36A02 pKA1U5 NM_024642.3  
GGTTCCGGGATCCGGGTCCTGGCCTCCACCGCCNCCTTGGGGCGCGCAGATCNCTGGCTG
HKR182178 ARi55H10 pGCAP10 NM_024642.3  
GGGCCTCCACCGCCGCCTTGGGGCGCGCAGATCGCTGGCTGCAGTTGGCGGGCGCATGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl