Prev. | 

RIKEN DNA Bank Human Resource - YRDC

Gene ID NCBI Gene 79693 |  KEGG hsa:79693
Gene Symbol YRDC
Protein Name yrdC N6-threonylcarbamoyltransferase domain containing
Synonyms DRIP3|IRIP|SUA5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067434 IRAK168J18 pBluescriptR BC067857 NM_024640 Partial
HGX069835 IRAK174J19 pCMV-SPORT6 BC080186 NM_024640 Full
HGY101976 IRAL054P16 pOTB7 BC068057 NM_024640 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322475 RBb06D03 pKA1U5 NM_024640.3  
GGCGGATGTCTCCGGCGCGTCGGTGCAGGGGGATGAGGGCCGCGGTGGCTGCCAGCGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl