Prev. |  KEGG KO K11513 > 

RIKEN DNA Bank Human Resource - CENPU

Gene ID NCBI Gene 79682 |  KEGG hsa:79682
Gene Symbol CENPU
Protein Name centromere protein U
Synonyms CENP50|CENPU50|KLIP1|MLF1IP|PBIP1
Ortholog resources KEGG ortholog (KEGG orthology K11513) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067309 IRAK168E13 pBluescriptR BC067802 NM_024629 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057283 ARe43D11 pKA1U5 NM_024629.2  
GGGAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGGCGCGGCCTCACAGGTCTGAGG
HKR222052 ARiS055C04 pGCAP10 NM_024629.2  
GGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGGCGCGGCCTCACAGGTCTGAGGGCG
HKR366128 RBd15F08 pGCAP10 NM_024629.2  
GGGAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGCCCCGGCCTCACAGGTCTGAGA
HKR381301 RBd53E05 pGCAP10 NM_024629.2  
GAGTCGCTCGAGAGCGGAGAGCGGCACCATGGCCCCGCGGGGGCGNNGGCGGCCGCGGCC
HKR381323 RBd53F03 pGCAP10 NM_024629.2  
GGAGAGCGGAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGCCGCGGCCTCACAGGT
HKR385751 RBd64G07 pGCAP10 NM_024629.2  
CGGCCGGCCGATGGGAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGCCGCGGCCTC
HKR403111 RBdS007M23 pGCAP10 NM_024629.2  
GGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGCCCCGGCCTCACAGGTCTGAGAGCG
HKR430011 RBdS075A11 pGCAP10 NM_024629.2  
GAGCTTCCAGTCGCTCGAGAGCGGAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGC
HKR442291 RBdS105M03 pGCAP10 NM_024629.2  
TGGTGACTACAAACAAAATATGATGAACTTAAAGAGAGAAAGTCTTCCCTTAGGAATGCA
HKR461715 RBdS154E19 pGCAP10 NM_024629.2  
GAGAGCGGCACCATGGCCCCGCGGGGGCGGCGGCGGCCGCGGCCTCACAGGTCTGAGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl