Prev. | 

RIKEN DNA Bank Human Resource - SMC6

Gene ID NCBI Gene 79677 |  KEGG hsa:79677
Gene Symbol SMC6
Protein Name structural maintenance of chromosomes 6
Synonyms SMC-6|SMC6L1|hSMC6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX016835 IRAK042B11 pCMV-SPORT6 BC022998 NM_024624 Partial/var
HGX033811 IRAK084I19 pCMV-SPORT6 BC039828 NM_024624 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094821 M01C037A21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE094869 M01C037C21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE094917 M01C037E21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE094965 M01C037G21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE095013 M01C037I21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE095061 M01C037K21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE095109 M01C037M21 pDONR221 MGC08-A11 BC039828 NM_024624  
HGE095157 M01C037O21 pDONR221 MGC08-A11 BC039828 NM_024624  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379732 RBd49F12 pGCAP10 NM_024624.4  
GGCGGTTAGTACCGCGGTGGGCGCCGGGGCTCCCGGGAATCTACCTTCTCCTGCGGCCGG
HKR430217 RBdS075J01 pGCAP10 NM_024624.4  
GGGGAATCTACCTTCTCCTGCGGCCGGCACGCGGTTCCCAGGGGGCCAGCGGCGGTCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl