Prev. |  KEGG KO K15523 > 

RIKEN DNA Bank Human Resource - FN3KRP

Gene ID NCBI Gene 79672 |  KEGG hsa:79672
Gene Symbol FN3KRP
Protein Name fructosamine 3 kinase related protein
Synonyms FN3KL
Ortholog resource in our bank

  FN3KRP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081785 IRAL004H17 pOTB7 BC001458 NM_024619 Partial/var
HGY089115 IRAL022N03 pOTB7 BC007611 NM_024619
HGY091952 IRAL029O16 pOTB7 BC014408 NM_024619 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005715 W01A014E19 pENTR-TOPO IRAL022N03 BC007611 NM_024619  
HGE005717 W01A014E21 pENTR-TOPO IRAL022N03 BC007611 NM_024619  
HGE005719 W01A014E23 pENTR-TOPO IRAL022N03 BC007611 NM_024619  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209249 ARiS023C01 pGCAP10 NM_024619.3  
GGCGGCCGCGGCGGGAACATGGAGGAGCTGCTGAGGCGCGAGCTGGGCTGCAGCTCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl