Prev. |  KEGG KO K12233 > 

RIKEN DNA Bank Human Resource - HECTD3

Gene ID NCBI Gene 79654 |  KEGG hsa:79654
Gene Symbol HECTD3
Protein Name HECT domain E3 ubiquitin protein ligase 3
Synonyms -
Ortholog resource in our bank

  HECTD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248895 ARiS122D23 pGCAP10 NM_024602.4 done
GGGTCGCGCCAGCTGTTCCCCGGGCAGGGTCGCCTCTAGGTGCTCACCTCCGCCACTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl